calcTm                 package:HELP                 R Documentation

_C_a_l_c_u_l_a_t_e _T_m

_D_e_s_c_r_i_p_t_i_o_n:

     Calculate melting temperature (Tm) using the nearest-neighbor
     base-stacking algorithm and the unified thermodynamic parameters.

_U_s_a_g_e:

     calcTm(x, ...)

_A_r_g_u_m_e_n_t_s:

       x: characters containing nucleotide sequences (ex: '"ATCGGAA"')
          or an object of class 'ExpressionSet' 

     ...: Additional arguments passed to methods:

          '_s_t_r_a_n_d_1._c_o_n_c_e_n_t_r_a_t_i_o_n' numeric value specifying
               concentration of strand 1 (default is 2e-07)

          '_s_t_r_a_n_d_2._c_o_n_c_e_n_t_r_a_t_i_o_n' numeric value specifying
               concentration of strand 2 (default is 2e-07)

          '_m_e_t_h_o_d' character value specifying the Tm algorithm to use
               (default is '"nearest-neighbor"'); currently not
               supported 

_V_a_l_u_e:

     Returns a numerical value indicating the predicted melting
     temperature (Tm) of the sequence in degrees Celsius. A value of
     'NA' is returned if the function encounters an error that prevents
     proper Tm calculation.

_A_u_t_h_o_r(_s):

     Reid F. Thompson (rthompso@aecom.yu.edu)

_R_e_f_e_r_e_n_c_e_s:

     Allawi, H.T. and SantaLucia, J., Jr. (1997) Thermodynamics and NMR
     of internal G.T mismatches in DNA, _Biochemistry_, *36*,
     10581-10594.

_S_e_e _A_l_s_o:

     'calcTm-methods', 'base.stacking.thermodynamics', 'calcGC'

_E_x_a_m_p_l_e_s:

     #demo(pipeline,package="HELP")

     calcTm("GTGTGGCTACAGGTGGGCCGTGGCGCACCTAAGTGAGGACAGAGAACAAC")
     calcTm("GTGTGGCTACAGGTGGGCCGTGGCGCACCTAAGTGAGGACAGAGAACAAC",strand1.concentration=1E-5,strand2.concentration=2E-8)

