findSequenceInGenome     package:GeneRegionScan     R Documentation

_F_i_n_d _a _s_e_q_u_e_n_c_e _i_n _g_e_n_o_m_e

_D_e_s_c_r_i_p_t_i_o_n:

     Wrapper around matchPDict that will accept a list of sequences and
     check if they are present in a given genome. Takes a long time to
     run.

_U_s_a_g_e:

         findSequenceInGenome(sequences, genome="BSgenome.Hsapiens.UCSC.hg18", verbose=TRUE,
         directions=c("matchForwardSense", "matchForwardAntisense", "matchReverseSense", "matchReverseAntisense"))

_A_r_g_u_m_e_n_t_s:

sequences: vector of character strings to scan. Should only contain A,
          C, G and T. Will be converted to DNAString.

  genome: character string with the name of the BSGenome in which
          sequences should be found. Defaults to the human genome.

 verbose: TRUE or FALSE.

directions: character string with elements from c("matchForwardSense",
          "matchForwardAntisense", "matchReverseSense",
          "matchReverseAntisense"). Defines which directions
          (complementary and reverse mirrorings) that should be
          scanned. Defaults to all directions.

_D_e_t_a_i_l_s:

     This function will take quite a while to run, so if you have a
     many sequences, overnight runs are recommended. BSgenome contains
     some alternative versions of chromosomes. They are marked with an
     underscore. This function automatically disregards chromosome
     names with an underscore, and this is known to work for the human
     genome. Nevertheless, check the output printed to terminal if all
     chromosomes are included.

_V_a_l_u_e:

     A data frame with a row for each identified match. Columns are
     "entrynumber","hitposInChr","chr", and "sequence" describing,
     respectively: the index of the sequence match, the position in the
     chromosome at which it was found, which chromosome it was found
     on, the sequence itself

_A_u_t_h_o_r(_s):

     Lasse Folkersen

_S_e_e _A_l_s_o:

     'BSgenome', 'matchPDict', 'excludeDoubleMatchingProbes'

_E_x_a_m_p_l_e_s:

             ## Not run: 
             #you can run this, but it takes quite a lot of time
             example<-findSequenceInGenome("CTGGCGAGCAGCGAATAATGGTTT")
             
     ## End(Not run)

